Query (optional)   in Class  

GrainGenes Marker Report: Xgpw3083-1A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw3083-1A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-1A51.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW3083



Probe for Locus
GPW3083
Locus
Xgpw3083-1A
General Remarks
Motif (CT)5
Type
PCR
SSR
PCR primers
Forward GGGCATAGCTGTCCAGAGAA
Reverse AAGATTTGGTGTGGAAGAGTGA
SSR size
Expected 312
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09