Query (optional)   in Class  

GrainGenes Marker Report: Xgpw3224-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw3224-4A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-4A100.1
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW3224



Probe for Locus
GPW3224
Locus
Xgpw3224-4A
General Remarks
Motif (TA)20(AG)17
Type
PCR
SSR
PCR primers
Forward AAGCTCAAAAGAGATTTGCATT
Reverse GGAAGTCCTTTCATCCCCTC
SSR size
Expected 214
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09