Query (optional)   in Class  

GrainGenes Marker Report: Xgpw3241-6B

[Submit comment/correction]

Locus
Xgpw3241-6B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-6B55
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW3241
Possible Orthologs
gpw3241
gpw3241-6B



Probe for Locus
GPW3241
Locus
Xgpw3241-6B
gpw3241
gpw3241-6B
General Remarks
Motif (GA)34.5
Type
PCR
SSR
PCR primers
Forward ATATAGGATTGGTGGGTCAACG
Reverse CAAATTCACATCCACTCCCC
SSR size
Expected 324
Amplification Conditions
Tm = 60C
Linkage Group
6B
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.