Query (optional)   in Class  

GrainGenes Marker Report: Xgpw349-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw349-2D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-2D135.9
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW349
Possible Orthologs
Xgpw349



Probe for Locus
GPW349
Locus
Xgpw349-2D
Xgpw349
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (AT)10(GT)20
Type
PCR
SSR
PCR primers
Forward TGCTGGCAATACAAACACAT
Reverse GGGCCTCACGAAAAATACCT
SSR size
Expected 146
Amplification Conditions
Tm = 60C
Linkage Group
2D
Source Species
Aegilops tauschii
Triticum aestivum
Data Source
Sourdille, Pierre2009.09