Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4043-2B

[Submit comment/correction]

Locus
Xgpw4043-2B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-2B105.4
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4043
Possible Orthologs
gpw4043
gpw4043-2B



Probe for Locus
GPW4043
Locus
Xgpw4043-2B
Sr47
gpw4043
gpw4043-2B
Reference
ReferenceKlindworth DL et al. (2012) Introgression and Characterization of a Goatgrass Gene for a High Level of Resistance to Ug99 Stem Rust in Tetraploid Wheat G3: Genes, Genomes, Genetics 2:665-673.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. Sr47 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Motif (GA)16
Type
PCR
SSR
PCR primers
Forward ACATATGCACGCACGCAC
Reverse CATTGACACCCCTGACACTC
5'- ACATATGCACGCACGCAC -3'
5'- CATTGACACCCCTGACACTC -3'
SSR size
Expected 162
Amplification Conditions
Tm = 60C
Denaturing step: 94C, 3 min. Touchdown step 1 (0.5C down each cycle until final annealing temperature): 94C, 30 sec; 65C, 30 sec; 72C, 2 min. Amplification step (30 cycles): 94C, 30 sec; 60C, 30 sec; 72C, 2 min. Extension step: 72C, 10 min
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.