Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4101-7B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4101-7B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-7B13.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4101



Probe for Locus
GPW4101
Locus
Xgpw4101-4B
Xgpw4101-7B
General Remarks
Motif (TC)18
Type
PCR
SSR
PCR primers
Forward TCCTAGATGGAGGTCTTGGC
Forward TCCTAGATGGAGGTCTTGGC
Reverse TCCTCCTCCCCATTTTGAG
Reverse TCCTCCTCCCCATTTTGAG
SSR size
Expected 135
Amplification Conditions
Tm = 60C
Linkage Group
4B/7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09