Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4140-7B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4140-7B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-7B32
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4140
Possible Orthologs
Xgpw4140-4B



Probe for Locus
GPW4140
Locus
Xgpw4140-4B
Xgpw4140-7B
General Remarks
Motif (CT)6(TC)14
Type
PCR
SSR
PCR primers
Forward AGTGGTTTCTATCCAGCACACA
Forward AGTGGTTTCTATCCAGCACACA
Reverse CGAAAATAAGACTCAAATGGGC
Reverse CGAAAATAAGACTCAAATGGGC
SSR size
Expected 332
Amplification Conditions
Tm = 60C
Linkage Group
7B/4B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09