Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4163-3D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4163-3D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3D74.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4163



Probe for Locus
GPW4163
Locus
Xgpw4163-3D
General Remarks
Motif (AGA)4(TC)21
Type
PCR
SSR
PCR primers
Forward TGGCAATGGAGGTAATGACA
Forward TGGCAATGGAGGTAATGACA
Reverse TGGTGCCCTAAAATTGGTTT
Reverse TGGTGCCCTAAAATTGGTTT
SSR size
Expected 389
Amplification Conditions
Tm = 60C
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09