Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4331-1B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4331-1B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-1B38
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4331
Possible Orthologs
Xgpw4331-1A



Probe for Locus
GPW4331
Locus
Xgpw4331-1A
Xgpw4331-1B
General Remarks
Motif (TC)13
Type
PCR
SSR
PCR primers
Forward AACCATGAGCACGGATTCTC
Forward AACCATGAGCACGGATTCTC
Reverse AAAGATCGCACCTGCACTG
Reverse AAAGATCGCACCTGCACTG
SSR size
Expected 176
Amplification Conditions
Tm = 60C
Linkage Group
1B/1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09