Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4388-4B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4388-4B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-4B45.7
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4388



Probe for Locus
GPW4388
Locus
Xgpw4388-4B
General Remarks
Motif (GT)28
Type
PCR
SSR
PCR primers
Forward GTCGGGTTCCTATACAAAGGG
Forward GTCGGGTTCCTATACAAAGGG
Reverse TATTCCAAAGTTGCCATCCC
Reverse TATTCCAAAGTTGCCATCCC
SSR size
Expected 247
Amplification Conditions
Tm = 60C
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09