Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4467-5D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4467-5D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-5D11
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4467



Probe for Locus
GPW4467
Locus
Xgpw4467-5D
General Remarks
Motif (TC)28
Type
PCR
SSR
PCR primers
Forward CAAAACCACGAAAACTCGGT
Forward CAAAACCACGAAAACTCGGT
Reverse GCACATTCCAGTCCCTTGTT
Reverse GCACATTCCAGTCCCTTGTT
SSR size
Expected 243
Amplification Conditions
Tm = 60C
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09