Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4496-7D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4496-7D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-7D172
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4496



Probe for Locus
GPW4496
Locus
Xgpw4496-7D
General Remarks
Motif (GT)18
Type
PCR
SSR
PCR primers
Forward ACTTCAGATGTGGGGGGAC
Forward ACTTCAGATGTGGGGGGAC
Reverse ATAGAACGTGTTGTTGACCCG
Reverse ATAGAACGTGTTGTTGACCCG
SSR size
Expected 113
Amplification Conditions
Tm = 60C
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09