Query (optional)   in Class  

GrainGenes Marker Report: Xgpw4545-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw4545-4A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-4A10.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW4545



Probe for Locus
GPW4545
Locus
Xgpw4545-4A
General Remarks
Motif (CT)15
Type
PCR
SSR
PCR primers
Forward TTGGGTCAGTGCTAGGGC
Forward TTGGGTCAGTGCTAGGGC
Reverse CTCCACTCCACTCCACTACTCC
Reverse CTCCACTCCACTCCACTACTCC
SSR size
Expected 146
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09