Query (optional)   in Class  

GrainGenes Marker Report: Xgpw5094-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw5094-4A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-4A179.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW5094
Possible Orthologs
Xgpw5094-3D



Probe for Locus
GPW5094
Locus
Xgpw5094-3D
Xgpw5094-4A
General Remarks
Motif (GA)18
Type
PCR
SSR
PCR primers
Forward GACGATCAACAGCGAGTCAA
Forward GACGATCAACAGCGAGTCAA
Reverse TTACAATCTCACCCTGGCAA
Reverse TTACAATCTCACCCTGGCAA
SSR size
Expected 242
Amplification Conditions
Tm = 60C
Linkage Group
3D/4A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09