Query (optional)   in Class  

GrainGenes Marker Report: Xgpw5122-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw5122-2D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-2D45.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW5122
Possible Orthologs
Xgpw5122-2A



Probe for Locus
GPW5122
Locus
Xgpw5122-2A
Xgpw5122-2D
General Remarks
Motif (CT)25
Type
PCR
SSR
PCR primers
Forward GTAGTCAATTCAGGCAACCTCC
Reverse TGATTCAAGTTCATGTGGTTCC
SSR size
Expected 235
Amplification Conditions
Tm = 60C
Linkage Group
2D/2A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09