Query (optional)   in Class  

GrainGenes Marker Report: Xgpw5188-3A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw5188-3A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3A188.7
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW5188
Possible Orthologs
Xgpw5188-1A



Probe for Locus
GPW5188
Locus
Xgpw5188-1A
Xgpw5188-3A
General Remarks
Motif (GA)43
Type
PCR
SSR
PCR primers
Forward TTTTCTGGTGTCTTTTGCTGG
Reverse GATTTGTTGATGCGTGCG
SSR size
Expected 276
Amplification Conditions
Tm = 60C
Linkage Group
3A/1A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09