Query (optional)   in Class  

GrainGenes Marker Report: Xgpw7053-3D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw7053-3D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3D12.7
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7053



Probe for Locus
GPW7053
Locus
Xgpw7053-3D
General Remarks
Motif (GCC)7
Type
PCR
SSR
PCR primers
Forward AATTCGGCACCAGAGAGAGC
Reverse GAGAAGGCGACGGAGGAGAT
Amplification Conditions
Tm = 60C
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09