Query (optional)   in Class  

GrainGenes Marker Report: Xgpw7219-3A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw7219-3A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3A123.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7219



Probe for Locus
GPW7219
Locus
Xgpw7219-3A
General Remarks
Motif (AGG)7
Type
PCR
SSR
PCR primers
Forward CCAAGAGGAAGCCCAAGAG
Forward CCAAGAGGAAGCCCAAGAG
Reverse CCACGGTGTGAGTAGTCGTC
Reverse CCACGGTGTGAGTAGTCGTC
SSR size
Expected 135
Amplification Conditions
Tm = 60C
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09