Query (optional)   in Class  

GrainGenes Marker Report: Xgpw7244-5B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw7244-5B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-5B32.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7244
Possible Orthologs
Xgpw7244-5D



Probe for Locus
GPW7244
Locus
Xgpw7244-5B
Xgpw7244-5D
General Remarks
Motif (CAG)13
Type
PCR
SSR
PCR primers
Forward CGCCTCATAGGAATGCTGTT
Forward CGCCTCATAGGAATGCTGTT
Reverse TGCTGTTGCAGTTGCTGTAGT
Reverse TGCTGTTGCAGTTGCTGTAGT
SSR size
Expected 167
Amplification Conditions
Tm = 60C
Linkage Group
5D/5B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09