Query (optional)   in Class  

GrainGenes Marker Report: Xgpw7565-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw7565-4A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-4A30.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7565



Probe for Locus
GPW7565
Locus
Xgpw7565-4A
General Remarks
Motif (GGT)7.7(TAAC)3
Type
PCR
SSR
PCR primers
Forward AATGGCAGTGGTGCTGGT
Forward AATGGCAGTGGTGCTGGT
Reverse AAAACTCACAGATGGGGACG
Reverse AAAACTCACAGATGGGGACG
SSR size
Expected 340
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09