Query (optional)   in Class  

GrainGenes Marker Report: Xgpw7772-2B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw7772-2B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-2B154.3
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7772



Probe for Locus
GPW7772
Locus
Xgpw7772-2B
General Remarks
Motif (CCG)8.3
Type
PCR
SSR
PCR primers
Forward CCGTCAGCCATCTGACTTCT
Forward CCGTCAGCCATCTGACTTCT
Reverse TCATGTTCCCCATTCCCC
Reverse TCATGTTCCCCATTCCCC
SSR size
Expected 105
Amplification Conditions
Tm = 60C
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09