Query (optional)   in Class  

GrainGenes Marker Report: Xgpw8188-7D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw8188-7D
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_7D-0.5
Ta-Synthetic/Opata-GPW-7D145.9
[ Show Nearby Loci ]
Breakpoint Interval
C-7DS-0.00-1.00*
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Probe
GPW8188



Probe for Locus
GPW8188
Locus
Xgpw8188-7D
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GAC)5
Type
PCR
SSR
PCR primers
Forward CATGGTCAACGTCTGGGTG
Forward CATGGTCAACGTCTGGGTG
Reverse CTTGGAGAGTAGGACGGCAG
Reverse CTTGGAGAGTAGGACGGCAG
SSR size
Expected 180
Amplification Conditions
Tm = 60C
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09