Query (optional)   in Class  

GrainGenes Marker Report: Xgpw8303-1B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw8303-1B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-1B38.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW8303



Probe for Locus
GPW8303
Locus
Xgpw8303-1B
General Remarks
Motif (TAC)6
Type
PCR
SSR
PCR primers
Forward TTTGATTTTACTGTTCATGCGG
Forward TTTGATTTTACTGTTCATGCGG
Reverse CATCGTAAATGTCGCACCC
Reverse CATCGTAAATGTCGCACCC
SSR size
Expected 239
Amplification Conditions
Tm = 60C
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09