Query (optional)   in Class  

GrainGenes Marker Report: Xgwm129

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm129
Type
Microsatellite
Chromosome
2B
5A
Map
Wheat, Avalon x Cadenza 5A158.5
Wheat, UC1110 x PI610750 5A41.5
Wheat-Composite2004-2B77
Wheat-Composite2004-5A27
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, UC1110 x PI610750
Probe
WMS129
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xgwm129-2B
[ Show all 7 ]



Probe for Locus
WMS129
Locus
Xgwm129-5A
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GT)8(N)28(GT)16
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCAGTGGGCAAGCTACACAG 3'
5' AAAACTTAGTAGCCGCGT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS129
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10