Query (optional)   in Class  

GrainGenes Marker Report: Xgwm131-5R

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm131-5R
Type
Microsatellite
Chromosome
5R
Map
Secale-N7xN2-2004-5R165.7
[ Show Nearby Loci ]
Map Data
Rye, N7 x N2, 2004
Species
Secale cereale
Probe
WMS131
Reference
ReferenceKhlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.
Possible Orthologs
gwm131
[ Show all 10 ]



Probe for Locus
WMS131
Locus
Rf3
[ Show all 12 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)22
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' AATCCCCACCGATTCTTCTC 3'
5' AGTTCGTGGGTCTCTGATGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS131
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15