Query (optional)   in Class  

GrainGenes Marker Report: Xgwm132

[Submit comment/correction]

Locus
Xgwm132
Type
Microsatellite
Chromosome
6B
6D
Map
Wheat, Avalon x Cadenza 2D127.3
Wheat-Composite2004-6B56
Wheat-Composite2004-6D27
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Probe
WMS132
Possible Orthologs
Xgwm132-2B
[ Show all 17 ]



Probe for Locus
WMS132
Locus
Xgwm132-6B
[ Show all 18 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)24(GAA)6imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TACCAAATCGAAACACATCAGG 3'
5' CATATCAAGGTCTCCTTCCCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS132
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.