Query (optional)   in Class  

GrainGenes Marker Report: Xgwm149-4B.2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm149-4B.2
Type
Microsatellite
Chromosome
4B
Chromosome Arm
4BL
Map
Tt-Oxd-QTL-4B119.2
[ Show Nearby Loci ]
Map Data
T. turgidum, Omrabi5 x dicoccoides, QTL
Probe
WMS149



Probe for Locus
WMS149
Locus
Xgwm149-4B
[ Show all 6 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)23imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CATTGTTTTCTGCCTCTAGCC 3'
5' CTAGCATCGAACCTGAACAAG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS149
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10