Query (optional)   in Class  

GrainGenes Marker Report: Xgwm154-5A

[ Submit comment/correction ]

Locus
Xgwm154-5A
Type
Microsatellite
Chromosome
5A
Chromosome Arm
5AS
Map
Chinese_Spring_Deletion_SSR_5A-0.865
[ Show all 8 ]
[ Show Nearby Loci ]
Breakpoint Interval
5AS3-0.75-0.98
Map Data
T. boeoticum x monococcum
[ Show all 8 ]
Probe
WMS154
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-5A, the interval most likely to contain locus is between Xgwm304 and Xbcd1871
Possible Orthologs
Xgwm154
[ Show all 7 ]



Probe for Locus
WMS154
Locus
Xgwm154
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)37imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCACAGAGAGAGAGGGAGGG 3'
5' ATGTGTACATGTTGCCTGCA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS154
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.