Query (optional)   in Class  

GrainGenes Marker Report: Xgwm157-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm157-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DL
Map
Chinese_Spring_Deletion_SSR_2D0.625
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
2DL3-0.49-0.76
Map Data
Wheat, Consensus SSR, 2004
[ Show all 6 ]
Probe
WMS157
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2D, the interval most likely to contain locus is between Xbcd111 and Xtam8
Possible Orthologs
Xgwm157
gwm157
gwm157-2D



Probe for Locus
WMS157
Locus
Xgwm157-2D
Xgwm157
Acph-D2
gwm157
gwm157-2D
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)14
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GTCGTCGCGGTAAGCTTG 3'
5' GAGTGAACACACGAGGCTTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS157
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10