Query (optional)   in Class  

GrainGenes Marker Report: Xgwm165-4B

[Submit comment/correction]

Locus
Xgwm165-4B
Type
Microsatellite
Chromosome
4B
Chromosome Arm
4BL
4BS
Map
Chinese_Spring_Deletion_SSR_4B0.93
[ Show all 14 ]
[ Show Nearby Loci ]
Breakpoint Interval
4BL1-0.86-1.00
Map Data
Durum wheat, Kofa x UC1113
[ Show all 14 ]
Species
Triticum aestivum
Probe
WMS165
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-4B, the interval most likely to contain locus is between Xbcd1265 and Xcdo1401
Possible Orthologs
Xgwm165-4A
[ Show all 13 ]



Probe for Locus
WMS165
Locus
Xgwm165.3-4A
[ Show all 14 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCAGTGGTCAGATGTTTCC 3'
5' CTTTTCTTTCAGATTGCGCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS165
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.