Query (optional)   in Class  

GrainGenes Marker Report: Xgwm2-3A.2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm2-3A.2
Type
Microsatellite
Chromosome
3A
Chromosome Arm
3AS
Probe
WMS2
Reference
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Possible Orthologs
Xgwm2
[ Show all 10 ]



Probe for Locus
WMS2
Locus
Xgwm2-3A
[ Show all 12 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks
Insert contains repeat (CA)18
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (CA)x18.
Product size 132 bp in Cheyenne.
Type
PCR
SSR
PCR primers
5' CTGCAAGCCTGTGATCAACT 3'
5' CATTCTCAAATGATCGAACA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS2
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17