Query (optional)   in Class  

GrainGenes Marker Report: Xgwm210-2B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm210-2B
Type
Microsatellite
Chromosome
2B
Chromosome Arm
2BS
Map
Chinese_Spring_Deletion_SSR_2B-0.92
Conan/Reeder-2B25.1982
Ta-SSR-2004-2B5.9
Ta-Synthetic/Opata-SSR-2B4.8
Tturgidum-SSR-2B-103
[ Show Nearby Loci ]
Breakpoint Interval
2BS4-0.84-1.00
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 6 ]
Probe
WMS210
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2B, the intervals most likely to contain locus are Xbcd348 - Xcdo456 or Xcdo456 - Xcdo447
Possible Orthologs
Xgwm210
[ Show all 10 ]



Probe for Locus
WMS210
Locus
Xgwm210.2-2A
[ Show all 11 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCATCAAGAATAGTGTGGAAG 3'
5' TGAGAGGAAGGCTCACACCT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS210
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15