Query (optional)   in Class  

GrainGenes Marker Report: Xgwm213-5B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm213-5B
Type
Microsatellite
Chromosome
5B
Chromosome Arm
5BL
Map
Chinese_Spring_Deletion_SSR_5B0.42
[ Show all 7 ]
[ Show Nearby Loci ]
Breakpoint Interval
5BL6-0.29-0.55
Map Data
T. turgidum, Messapia x dicoccoides, SSR
[ Show all 7 ]
Probe
WMS213
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Possible Orthologs
Xgwm213
[ Show all 9 ]



Probe for Locus
WMS213
Locus
Xgwm213-5B
[ Show all 10 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)35
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCCTGGCTCGTTCTATCTC 3'
5' CTAGCTTAGCACTGTCGCCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS213
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15