Query (optional)   in Class  

GrainGenes Marker Report: Xgwm291-5A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm291-5A
Type
Microsatellite
Chromosome
5A
Chromosome Arm
5AL
Map
Ta-SSR-2004-5A164
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
T. turgidum, Messapia x dicoccoides, SSR
[ Show all 7 ]
Species
Triticum aestivum
Probe
WMS291
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-5A, the interval most likely to contain locus is distal to Xmwg2112
Possible Orthologs
Xgwm291
[ Show all 10 ]



Probe for Locus
WMS291
Locus
Xgwm291-5A
[ Show all 12 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)35
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CATCCCTACGCCACTCTGC 3'
5' AATGGTATCTATTCCGACCCG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS291
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15