Query (optional)   in Class  

GrainGenes Marker Report: Xgwm311-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm311-2D
Type
Microsatellite
Chromosome
2D
Map
Chinese_Spring_Deletion_SSR_2D0.88
Ta-Synthetic/Opata-SSR-2D147.4
[ Show Nearby Loci ]
Breakpoint Interval
2DL9-0.76-1.00
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, SSR
Probe
WMS311
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2D, the intervals most likely to contain locus are Xcdo1008 - Xcdo36 or distal to Xcdo36
Possible Orthologs
Xgwm311-2A
[ Show all 10 ]



Probe for Locus
WMS311
Locus
Xgwm311.2-2A
[ Show all 11 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)29
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCACGTGGAAGACGCTCC 3'
5' CTACGTGCACCACCATTTTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS311
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15