Query (optional)   in Class  

GrainGenes Marker Report: Xgwm325

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm325
Type
Microsatellite
Chromosome
6D
Map
Wheat, Avalon x Cadenza 6D44.8
Wheat-Composite2004-6D101
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Probe
WMS325
Possible Orthologs
Xgwm325-6B
Xgwm325-6D
Xgwm325B
gwm325
gwm325-6D



Probe for Locus
WMS325
Locus
Xgwm325-6B
[ Show all 6 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)16
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TTTCTTCTGTCGTTCTCTTCCC 3'
5' TTTTTACGCGTCAACGACG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS325
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10