Query (optional)   in Class  

GrainGenes Marker Report: Xgwm382-2B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm382-2B
Type
Microsatellite
Chromosome
2B
Map
Chinese_Spring_Deletion_SSR_2B0.18
Ta-SSR-2004-2B114.2
Ta-Synthetic/Opata-BARC-2B106
Ta-Synthetic/Opata-SSR-2B207.7
[ Show Nearby Loci ]
Breakpoint Interval
C-2BL2-0.36
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, SSR
2 Point Data
Lr50/Xgwm382Distance: 6.7 cM
Probe
WMS382
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2B, the interval most likely to contain locus is between Xcmwg660 and Xcdo36
Possible Orthologs
Xgwm382
[ Show all 16 ]



Probe for Locus
WMS382
Locus
Xgwm382-2A
[ Show all 18 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)26
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GTCAGATAACGCCGTCCAAT 3'
5' CTACGTGCACCACCATTTTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS382
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15