Query (optional)   in Class  

GrainGenes Marker Report: Xgwm389

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm389
Type
Microsatellite
Chromosome
3B
Chromosome Arm
3BS
Map
Svevo/Ciccio-3B6
Ta-NxW-3B2.7
Tt-LxG-3B0
Wheat, Avalon x Cadenza 3B73.9
Wheat-Composite2004-3B10
[ Show Nearby Loci ]
Breakpoint Interval
3AL5-0.78-1.00
Map Data
Durum wheat, Svevo x Ciccio
T. turgidum, Langdon x G18-16
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
WMS389
Possible Orthologs
gwm389
Xgwm389-3B
gwm389-3B
gwm389-3A



Probe for Locus
WMS389
Locus
Xgwm389-3B
[ Show all 6 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)14(GT)16
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' ATCATGTCGATCTCCTTGACG 3'
5' TGCCATGCACATTAGCAGAT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS389
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15