Query (optional)   in Class  

GrainGenes Marker Report: Xgwm415-5A

[ Submit comment/correction ]

Locus
Xgwm415-5A
Type
Microsatellite
Chromosome
5A
Map
Chinese_Spring_Deletion_SSR_5A-0.2
[ Show all 7 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-5AS1-0.40
Map Data
Wheat, Consensus SSR, 2004
[ Show all 7 ]
Probe
WMS415
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-5A, the interval most likely to contain locus is between Xgwm304 and Xbcd1871
Possible Orthologs
Xgwm415
Xgwm415-5B
gwm415
gwm415-5A



Probe for Locus
WMS415
Locus
Xgwm415-5A
Xgwm415
Xgwm415-5B
gwm415
gwm415-5A
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)25imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GATCTCCCATGTCCGCC 3'
5' CGACAGTCGTCACTTGCCTA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS415
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.