Query (optional)   in Class  

GrainGenes Marker Report: Xgwm43-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm43-4A
Type
Microsatellite
Chromosome
4A
Chromosome Arm
4AL
Map
Tt-Oxd-QTL-4A118.6
[ Show Nearby Loci ]
Map Data
T. turgidum, Omrabi5 x dicoccoides, QTL
Probe
WMS43
Possible Orthologs
Xgwm43
Xgwm43-7B
gwm43
gwm43-7B



Probe for Locus
WMS43
Locus
Xgwm43-7B
Xgwm43
Xgwm43-4A
gwm43
gwm43-7B
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks
Insert contains repeat (CA)22
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (CA)x22.
Product size 180 bp in Chinese Spring.
Type
PCR
SSR
PCR primers
5' CACCGACGGTTTCCCTAGAGT 3'
5' GGTGAGTGCAAATGTCATGTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS43
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17
Korzun, Victor N.97.10