Query (optional)   in Class  

GrainGenes Marker Report: Xgwm493

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm493
Type
Microsatellite
Chromosome
3B
Chromosome Arm
3BS
Map
Svevo/Ciccio-3B20.4
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
3AL5-0.78-1.00
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 6 ]
2 Point Data
Yrns-B1/Xgwm493#1Distance: 20.5 cM
Yrns-B1/Xgwm493#2Distance: 21.7 cM
Probe
WMS493
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xgwm493-3B
Xgwm493-3B.1
Xgwm493-3B.2
gwm493
gwm493-3B



Probe for Locus
WMS493
Locus
Xgwm493-3B
[ Show all 7 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)43imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TTCCCATAACTAAAACCGCG 3'
5' GGAACATCATTTCTGGACTTTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS493
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15