Query (optional)   in Class  

GrainGenes Marker Report: Xgwm513b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm513b
Type
Microsatellite
Chromosome
4B
Map
Wheat-Composite2004-4B43
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS513
Possible Orthologs
Xgwm513
[ Show all 14 ]



Probe for Locus
WMS513
Locus
Xgwm513-4B
[ Show all 15 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)12
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' ATCCGTAGCACCTACTGGTCA 3'
5' GGTCTGTTCATGCCACATTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS513
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15