Query (optional)   in Class  

GrainGenes Marker Report: Xgwm533-3B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm533-3B
Type
Microsatellite
Chromosome
3B
3B Triticum aestivum
Chromosome Arm
3BS
Map
Chinese_Spring_Deletion_SSR_3B-0.675
[ Show all 8 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QDon.crc-3B
QFhs.crc-3B.1
QFhs.ndsu-3B
QFhs.ndsu-3BS
Breakpoint Interval
3BS9-0.57-0.78
Map Data
Wheat, Chinese Spring x SQ1
[ Show all 8 ]
Species
Triticum aestivum
Probe
WMS533
Reference
ReferenceLiu SX and Anderson JA (2003) Marker assisted evaluation of Fusarium head blight resistant wheat germplasm Crop Science 43:760-766.
ReferenceGuo PG et al. (2003) AFLP and STS tagging of a major QTL for Fusarium head blight resistance in wheat Theoretical and Applied Genetics 106:1011-1017.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferenceAnderson JA et al. (2001) DNA markers for Fusarium head blight resistance QTLs in two wheat populations Theoretical and Applied Genetics 102:1164-1168.
Possible Orthologs
gwm533
[ Show all 11 ]



Probe for Locus
WMS533
Locus
Xgwm533-3B
[ Show all 14 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)18(CA)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' AAGGCGAATCAAACGGAATA 3'
5' GTTGCTTTAGGGGAAAAGCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS533
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15