Query (optional)   in Class  

GrainGenes Marker Report: Xgwm538-4B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm538-4B
Type
Microsatellite
Chromosome
4B
Chromosome Arm
4BL
Map
Chinese_Spring_Deletion_SSR_4B0.93
[ Show all 10 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QKB.ksu-4BL
Breakpoint Interval
4BL1-0.86-1.00
Map Data
T. turgidum, Messapia x dicoccoides, SSR
[ Show all 10 ]
Species
Triticum aestivum
Probe
WMS538
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSukhwinder S et al. (2003) Mapping of a resistance gene effective against Karnal bunt pathogen of wheat Theoretical and Applied Genetics 106:287-292.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-4B, the interval most likely to contain locus is between Xfbb67 and Xfba177
Possible Orthologs
Xgwm538
Xgwm538-5R
gwm538
gwm538-4B



Probe for Locus
WMS538
Locus
Xgwm538
Xgwm538-4B
Xgwm538-5R
gwm538
gwm538-4B
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GT)6(T)(GT)10
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GCATTTCGGGTGAACCC 3'
5' GTTGCATGTATACGTTAAGCGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS538
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15