Query (optional)   in Class  

GrainGenes Marker Report: Xgwm539-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm539-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DL
Map
Chinese_Spring_Deletion_SSR_2D0.245
[ Show all 11 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QFhs.crc-2D
Breakpoint Interval
C-2DL3-0.49
Map Data
Wheat, Arina x Forno
[ Show all 11 ]
Species
Triticum aestivum
Probe
WMS539
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2D, the interval most likely to contain locus is between Xtam8 and Xfbb122
Possible Orthologs
Xgwm539
gwm539-2D
gwm539



Probe for Locus
WMS539
Locus
Xgwm539-2D
Xgwm539
gwm539
gwm539-2D
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)27
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CTGCTCTAAGATTCATGCAACC 3'
5' GAGGCTTGTGCCCTCTGTAG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS539
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15