Query (optional)   in Class  

GrainGenes Marker Report: Xgwm595

[Submit comment/correction]

Locus
Xgwm595
Type
Microsatellite
Chromosome
5A
Map
Ta-NxW-5A237.2
Wheat, Avalon x Cadenza 5A195.2
Wheat, UC1110 x PI610750 5A176.8
Wheat, WH542 x Synthetic 5A35.8
Wheat-Composite2004-5A101
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Wheat, UC1110 x PI610750
Wheat, WH542 x Synthetic
Probe
WMS595
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xgwm595-5A
[ Show all 12 ]



Probe for Locus
WMS595
Locus
Xgwm595
[ Show all 13 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)39imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GCATAGCATCGCATATGCAT 3'
5' GCCACGCTTGGACAAGATAT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS595
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.