Query (optional)   in Class  

GrainGenes Marker Report: Xgwm610-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm610-4A
Type
Microsatellite
Chromosome
4A
Chromosome Arm
4AL
Map
Chinese_Spring_Deletion_SSR_4A-0.1
[ Show all 7 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-4AS1-0.20
Map Data
T. turgidum, Messapia x dicoccoides, SSR
[ Show all 7 ]
Probe
WMS610
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-4A, the interval most likely to contain locus is between Xbcd402 and Xwg622
Possible Orthologs
Xgwm610
Xgwm610a
Xgwm610b
gwm610
gwm610-4A



Probe for Locus
WMS610
Locus
Xgwm610
[ Show all 6 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)17imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CTGCCTTCTCCATGGTTTGT 3'
5' AATGGCCAAAGGTTATGAAGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS610
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15