Query (optional)   in Class  

GrainGenes Marker Report: Xgwm63-7A

[Submit comment/correction]

Locus
Xgwm63-7A
Type
Microsatellite
Chromosome
7A
Chromosome Arm
7AL
Map
Chinese_Spring_Deletion_SSR_7A0.88
Ta-SSR-2004-7A103.9
Ta-Synthetic/Opata-GPW-7A204.3
Ta-Synthetic/Opata-SSR-7A157.3
Tt-Oxd-QTL-7A124.6
[ Show Nearby Loci ]
Breakpoint Interval
7AL16-0.86-0.90
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 7 ]
Probe
WMS63
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-7A, the interval most likely to contain locus is between Xgwm276 and XksuH9
Possible Orthologs
Xgwm63
gwm63



Probe for Locus
WMS63
Locus
Xgwm63-7A
Xgwm63
gwm63
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)17(TA)21
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCGACCTGATCGCCCCTA 3'
5' CGCCCTGGGTGATGAATAGT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS63
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.