Query (optional)   in Class  

GrainGenes Marker Report: Xgwm635

[Submit comment/correction]

Locus
Xgwm635
Type
Microsatellite
Chromosome
7A
Map
Ta-NxW-7A29.3
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Wheat, WH542 x Synthetic
2 Point Data
Dn8/Xgwm635
Probe
WMS635
Possible Orthologs
Xgwm635-7A
[ Show all 13 ]



Probe for Locus
WMS635
Locus
Xgwm635b-7A
[ Show all 14 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)10(GA)14
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TTCCTCACTGTAAGGGCGTT 3'
5' CAGCCTTAGCCTTGGCG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS635
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.