Query (optional)   in Class  

GrainGenes Marker Report: Xgwm66b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm66b
Type
Microsatellite
Chromosome
5B
Map
Wheat-Composite2004-5B44
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS66
Possible Orthologs
Xgwm66
[ Show all 9 ]



Probe for Locus
WMS66
Locus
Xgwm66-4B
[ Show all 10 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)30(TA)21
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CCAAAGACTGCCATCTTTCA 3'
5' CATGACTAGCTAGGGTGTGACA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS66
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15